Handmade quality · Free shipping over $75 · Explore the atelier

Immortalized RFP-Expressing Porcine Primary Tracheal Epithelial Cells Antibodies (S-Z) Only for staining of cell

SKU: 50507220289

4.6
USD1600.00 USD1644.00

Pay in 4 interest-free payments of $400.00 Learn more

Shipping Estimate
USA
  • USA
  • CAN

Ships within 48 hours · Estimated delivery Sep 15 - Sep 20

Description

Only for staining of cell morphology and histomorphology observation

This product was previously listed under catalog number 15-99168 and is now updated to BF-36137462 for improved product management

Reverse Primer: ATAAGAGCTCCCAAGACTTAG

method validation required for other strains

Immortalized RFP-Expressing Porcine Primary Tracheal Epithelial Cells Antibodies (S-Z) Only for staining of cellDocuments P 6033IM. RFP

Exchange/Return Notes
  • We offer a 30-day return/exchange service after receiving.
  • Final sale items are not eligible for returns or exchanges.
  • To process your return/exchange, please contact us at [email protected]
  • Please click here for more details>>> Return & Exchange Policy

You may also like

recommand products